marta lwin
ITP masters thesis 2006:
polymorphic [d(eoxyribo)n(ucleic) a(cid)]: a love story
contact marta (at) metabreed (dot) com
|
|
This installation is created by recoding personal DNA sequences, of the artist and her partner, into spoken conversation by using algorithmic rule based programming.
DNA sequences were derived from whole blood, and extracted by to Rebecka Pestoff and Carole Oddoux, Ph.D., at the the Molecular Genetics Laboratory NYU School of Medicine. Following, the extracted DNA was sequenced by Rebecca Budinoff and Warren Weaver, at the Comparative Genetics Laboratory American Museum of Natural History.
Links to documentation:
DNA extraction lab documentation
DNA amplification lab documentation
DNA sequencing lab documentation
sample sequence: AAACTAGGATTAGATACCCTATTATGCTTAGCCCTAAACCTCAACAGTTA
AATCAACAAAACTGCTCGCCAGAACACTACGAGCCACAGCTTAAAACTCA
AAGGACCTGGCGGTGCTTCATATCCCTCTAGAGGAGCCTGTTCTGTAATC
GATAAACCCCGATCAACCTCACCACCTCTTGCTCAGCCTATATACCGCCA
TCTTCAGCAAACCCTGATGAAGGCTACAAAGTAAGCGCAAGTACCCACGT
AAAGACGTTAGGTCAAGGTGTAGCCCATGAGGTGGCAAGAAATGGGCTAC
ATTTTCTACCCCAGAAAACTACGATAGCCCTTATGAAACTTAAGGGTCGA
AGGTGGATTTAGCAGTAAACTGAGAGTAGAGTGCTTAGTTGAACAGGGCC
CTGAAGCGCGTACACATCGCCCGTC
This installation consists two wall mounted plates containing samples of DNA and corresponding digital sequences from my partner and I. The DNA sequence is derived from a collaboration between myself and scientists at NYU Medical Center, Study of Human Genomics, and the American Museum of Natural History, Center for Comparative Genomics. The DNA sequences are visualized by using two video monitors (with audio), and computers running custom software written in Java. A synergistic interaction exists between the DNA sequence and the custom software to trigger video. The video depicts lips speaking the DNA sequence, mapped to the Roman alphabet. The disembodied lips take turns speaking the code to one another, at times interrupting, at other times remaining silent. The DNA, while invisible is encased in visible plates which are laser etched with contemporary scientific iconography, creating a decorative surface polymorphic [d(eoxyribo)n(ucleic) a(cid)]: a love story looks at the contemporary methodology for encoding DNA, and it's application and ethical ambiguities. The web based documented process of creating the installation comprises the theoretical investigation of turning material DNA into binary information, with special attention to lab process. I am looking at the current scientific lab practice of extracting DNA, and treatment of human materiality as it moves into binary representation. With special attention to Norbert Wiener's cybernetic theory, Lily Kay's analysis of the inherent informatic bias in DNA science, and theoretical writings by Marx, Deleuze + Guattari, and contemporary thinkers such as Thacker, Massumi, and Agamben.
A short clip of the polymorphic [d(eoxyribo)n(ucleic) a(cid)]: a love story installation:
video clip (quicktime 872kb)
|
|